Chain reaction - PDFSEARCH.IO - Document Search Engine

Chain reaction
Results: 4345

#	Item
501	Researcher loads samples for DNA analysis Add to Reading List Source URL: scientifix.com.au Language: English - Date: 2015-03-31 21:04:00 Chemistry Polymerase chain reaction Laboratory techniques Amplifiers Epigenetics Takara Holdings Bisulfite sequencing DNA sequencing Multiplex polymerase chain reaction Biology Molecular biology Biochemistry
502	Sponsored document from Journal of Feline Medicine and Surgery Published as: J Feline Med SurgApril ; 10(2-3): 167–174. Add to Reading List Source URL: www.2ndchance.info Language: English - Date: 2014-02-04 17:38:13 Chemistry Polymerase chain reaction Laboratory techniques Animal virology Viruses Feline coronavirus Viral load Reverse transcription polymerase chain reaction Reverse transcriptase Biology Molecular biology Biochemistry
503	category primer sequence SSLP markers zC250L3F GGGTTTGTGAATGGAATGATG zC250L3R AGCGTCCACTGCTCAGAATC zC74M13F CCTCCTCCCAAAAACACATC Add to Reading List Source URL: jhoonline.org Language: English Chemistry Polymerase chain reaction Laboratory techniques DNA methyltransferase Biotechnology DNMT1 Real-time polymerase chain reaction Primer Biology Molecular biology Biochemistry
504	Microbial DNA Sample Preparation Microbial Sequencing Program DNA Sample Submission Guidelines The JGI has sequenced over 3000 prokaryotic, eukaryotic and metagenomic projects and finished over 300 genomes. DNA quality Add to Reading List Source URL: 1ofdmq2n8tc36m6i46scovo2e.wpengine.netdna-cdn.com Language: English - Date: 2014-04-03 15:30:40 Chemistry Genomics Laboratory techniques Polymerase chain reaction Bioinformatics Metagenomics Gel electrophoresis Genome DNA Biology Molecular biology Biochemistry
505	Validation of two real-time PCRs targeting the PE-PGRS 20 gene and the region of difference 4 for the characterization of Mycobacterium bovis isolates M.L. Sales1, A.A. Fonseca Jr.1, L. Orzil1, A.P. Alencar1, M.A. Hodon1 Add to Reading List Source URL: www.alice.cnptia.embrapa.br Language: English - Date: 2015-03-19 00:33:00 Microbiology Acid fast bacilli Corynebacterineae Mycobacteria Mycobacterium M. bovis Polymerase chain reaction Real-time polymerase chain reaction Tuberculin Bacteria Tuberculosis Biology
506	Plant DNA Sample Preparation Plant Sequencing Program DNA Sample Submission Guidelines The JGI has sequenced over 3000 prokaryotic, eukaryotic and metagenomic projects and finished over 300 genomes. DNA quality (molecul Add to Reading List Source URL: 1ofdmq2n8tc36m6i46scovo2e.wpengine.netdna-cdn.com Language: English - Date: 2014-04-03 15:31:18 Chemistry Genomics DNA Laboratory techniques Polymerase chain reaction Gel electrophoresis DNA profiling Genome Metagenomics Biology Genetics Molecular biology
507	AMMI Canada – CACMID Annual Conference April 16 –18, 2015 • Charlottetown, Prince Edward Island O R A L P RE S E NTAT I ONS Thursday, April 16, 2015 Session A Add to Reading List Source URL: ammi.ca Language: English - Date: 2015-04-08 15:24:47 Molecular biology Antibiotic-resistant bacteria Bacterial diseases Laboratory techniques Polymerase chain reaction Linezolid Methicillin-resistant Staphylococcus aureus Influenza vaccine Multilocus sequence typing Bacteria Biology Microbiology
508	A peer-reviewed version of this preprint was published in PeerJ on 19 AugustView the peer-reviewed version (peerj.com/articles/520), which is the preferred citable publication unless you specifically need to cite Add to Reading List Source URL: peerj.com Language: English - Date: 2014-07-11 19:45:23 DNA sequencing Biotechnology Genomics Bioinformatics Sequence assembly Contig Ion semiconductor sequencing Polymerase chain reaction Chromatin immunoprecipitation Biology Molecular biology Biochemistry
509	Fire Lab 1997 Vector Supplement- Februarygfp variants PCR-based gfp tagging restriction-site-based gfp tagging gfp intron-tagging Add to Reading List Source URL: www.addgene.org Language: English - Date: 2011-07-16 08:53:32 Green fluorescent protein Vector Gene expression Restriction enzyme Transcription RNA splicing Intron Polymerase chain reaction Mosaic Biology Molecular biology Biochemistry
510	Huntington disease Reference Materials Characterized by the GeT-RM CAG Repeat Length as Determined by: Sequencing (1 Lab) Mean3 Add to Reading List Source URL: wwwn.cdc.gov Language: English - Date: 2013-02-13 14:47:02 Biochemistry Polymerase chain reaction Laboratory techniques Biotechnology DNA DNA profiling Variants of PCR COLD-PCR Biology Molecular biology Chemistry

UPDATE